ID: 1035626150

View in Genome Browser
Species Human (GRCh38)
Location 8:1072120-1072142
Sequence CCGTCAAGGCACACAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035626141_1035626150 20 Left 1035626141 8:1072077-1072099 CCTGCCATGAAGTCGTGCTTAGA No data
Right 1035626150 8:1072120-1072142 CCGTCAAGGCACACAGTGGAGGG No data
1035626140_1035626150 24 Left 1035626140 8:1072073-1072095 CCGTCCTGCCATGAAGTCGTGCT No data
Right 1035626150 8:1072120-1072142 CCGTCAAGGCACACAGTGGAGGG No data
1035626142_1035626150 16 Left 1035626142 8:1072081-1072103 CCATGAAGTCGTGCTTAGAGTTA No data
Right 1035626150 8:1072120-1072142 CCGTCAAGGCACACAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035626150 Original CRISPR CCGTCAAGGCACACAGTGGA GGG Intergenic
No off target data available for this crispr