ID: 1035626312

View in Genome Browser
Species Human (GRCh38)
Location 8:1073664-1073686
Sequence CTGTGTGTGCATTTTGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035626310_1035626312 -8 Left 1035626310 8:1073649-1073671 CCCTGCACAGAGGAGCTGTGTGT No data
Right 1035626312 8:1073664-1073686 CTGTGTGTGCATTTTGTAGATGG No data
1035626311_1035626312 -9 Left 1035626311 8:1073650-1073672 CCTGCACAGAGGAGCTGTGTGTG No data
Right 1035626312 8:1073664-1073686 CTGTGTGTGCATTTTGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035626312 Original CRISPR CTGTGTGTGCATTTTGTAGA TGG Intergenic
No off target data available for this crispr