ID: 1035627722

View in Genome Browser
Species Human (GRCh38)
Location 8:1084979-1085001
Sequence GGAACCCTGTTCGCTGTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035627722_1035627725 3 Left 1035627722 8:1084979-1085001 CCACTAACAGCGAACAGGGTTCC No data
Right 1035627725 8:1085005-1085027 TTCTCCACATCAAAAACTCTTGG No data
1035627722_1035627727 20 Left 1035627722 8:1084979-1085001 CCACTAACAGCGAACAGGGTTCC No data
Right 1035627727 8:1085022-1085044 TCTTGGTATCTTTTGTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035627722 Original CRISPR GGAACCCTGTTCGCTGTTAG TGG (reversed) Intergenic
No off target data available for this crispr