ID: 1035630730

View in Genome Browser
Species Human (GRCh38)
Location 8:1104838-1104860
Sequence CCACTTCCTGCTCTCTGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035630730_1035630737 18 Left 1035630730 8:1104838-1104860 CCTCACCAGAGAGCAGGAAGTGG No data
Right 1035630737 8:1104879-1104901 GCAGGGCCTCTGAAGAGCACCGG No data
1035630730_1035630734 1 Left 1035630730 8:1104838-1104860 CCTCACCAGAGAGCAGGAAGTGG No data
Right 1035630734 8:1104862-1104884 GTGTGCTTCCTCCATCTGCAGGG No data
1035630730_1035630733 0 Left 1035630730 8:1104838-1104860 CCTCACCAGAGAGCAGGAAGTGG No data
Right 1035630733 8:1104861-1104883 AGTGTGCTTCCTCCATCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035630730 Original CRISPR CCACTTCCTGCTCTCTGGTG AGG (reversed) Intergenic
No off target data available for this crispr