ID: 1035635612

View in Genome Browser
Species Human (GRCh38)
Location 8:1141446-1141468
Sequence TCTTCTAACCATCAGCTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035635612_1035635614 22 Left 1035635612 8:1141446-1141468 CCACACAGCTGATGGTTAGAAGA No data
Right 1035635614 8:1141491-1141513 AAAAATGTAATCCAGAATGTTGG No data
1035635612_1035635615 30 Left 1035635612 8:1141446-1141468 CCACACAGCTGATGGTTAGAAGA No data
Right 1035635615 8:1141499-1141521 AATCCAGAATGTTGGTGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035635612 Original CRISPR TCTTCTAACCATCAGCTGTG TGG (reversed) Intergenic
No off target data available for this crispr