ID: 1035636100

View in Genome Browser
Species Human (GRCh38)
Location 8:1145398-1145420
Sequence CCAGCTCAGCCAGGTCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035636100_1035636107 26 Left 1035636100 8:1145398-1145420 CCTGGGAGACCTGGCTGAGCTGG No data
Right 1035636107 8:1145447-1145469 CACTGTGGTCTCCCGTCCTGTGG No data
1035636100_1035636105 11 Left 1035636100 8:1145398-1145420 CCTGGGAGACCTGGCTGAGCTGG No data
Right 1035636105 8:1145432-1145454 CTCTGTACATGACTCCACTGTGG No data
1035636100_1035636108 27 Left 1035636100 8:1145398-1145420 CCTGGGAGACCTGGCTGAGCTGG No data
Right 1035636108 8:1145448-1145470 ACTGTGGTCTCCCGTCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035636100 Original CRISPR CCAGCTCAGCCAGGTCTCCC AGG (reversed) Intergenic
No off target data available for this crispr