ID: 1035636103

View in Genome Browser
Species Human (GRCh38)
Location 8:1145407-1145429
Sequence CACCACACACCAGCTCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035636103_1035636105 2 Left 1035636103 8:1145407-1145429 CCTGGCTGAGCTGGTGTGTGGTG No data
Right 1035636105 8:1145432-1145454 CTCTGTACATGACTCCACTGTGG No data
1035636103_1035636108 18 Left 1035636103 8:1145407-1145429 CCTGGCTGAGCTGGTGTGTGGTG No data
Right 1035636108 8:1145448-1145470 ACTGTGGTCTCCCGTCCTGTGGG No data
1035636103_1035636107 17 Left 1035636103 8:1145407-1145429 CCTGGCTGAGCTGGTGTGTGGTG No data
Right 1035636107 8:1145447-1145469 CACTGTGGTCTCCCGTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035636103 Original CRISPR CACCACACACCAGCTCAGCC AGG (reversed) Intergenic
No off target data available for this crispr