ID: 1035636104

View in Genome Browser
Species Human (GRCh38)
Location 8:1145431-1145453
Sequence CACAGTGGAGTCATGTACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035636104_1035636108 -6 Left 1035636104 8:1145431-1145453 CCTCTGTACATGACTCCACTGTG No data
Right 1035636108 8:1145448-1145470 ACTGTGGTCTCCCGTCCTGTGGG No data
1035636104_1035636107 -7 Left 1035636104 8:1145431-1145453 CCTCTGTACATGACTCCACTGTG No data
Right 1035636107 8:1145447-1145469 CACTGTGGTCTCCCGTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035636104 Original CRISPR CACAGTGGAGTCATGTACAG AGG (reversed) Intergenic