ID: 1035636105

View in Genome Browser
Species Human (GRCh38)
Location 8:1145432-1145454
Sequence CTCTGTACATGACTCCACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035636094_1035636105 30 Left 1035636094 8:1145379-1145401 CCACTCGCCCAGCGTGGGGCCTG No data
Right 1035636105 8:1145432-1145454 CTCTGTACATGACTCCACTGTGG No data
1035636098_1035636105 22 Left 1035636098 8:1145387-1145409 CCAGCGTGGGGCCTGGGAGACCT No data
Right 1035636105 8:1145432-1145454 CTCTGTACATGACTCCACTGTGG No data
1035636100_1035636105 11 Left 1035636100 8:1145398-1145420 CCTGGGAGACCTGGCTGAGCTGG No data
Right 1035636105 8:1145432-1145454 CTCTGTACATGACTCCACTGTGG No data
1035636097_1035636105 23 Left 1035636097 8:1145386-1145408 CCCAGCGTGGGGCCTGGGAGACC No data
Right 1035636105 8:1145432-1145454 CTCTGTACATGACTCCACTGTGG No data
1035636103_1035636105 2 Left 1035636103 8:1145407-1145429 CCTGGCTGAGCTGGTGTGTGGTG No data
Right 1035636105 8:1145432-1145454 CTCTGTACATGACTCCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035636105 Original CRISPR CTCTGTACATGACTCCACTG TGG Intergenic