ID: 1035636107

View in Genome Browser
Species Human (GRCh38)
Location 8:1145447-1145469
Sequence CACTGTGGTCTCCCGTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035636104_1035636107 -7 Left 1035636104 8:1145431-1145453 CCTCTGTACATGACTCCACTGTG No data
Right 1035636107 8:1145447-1145469 CACTGTGGTCTCCCGTCCTGTGG No data
1035636100_1035636107 26 Left 1035636100 8:1145398-1145420 CCTGGGAGACCTGGCTGAGCTGG No data
Right 1035636107 8:1145447-1145469 CACTGTGGTCTCCCGTCCTGTGG No data
1035636103_1035636107 17 Left 1035636103 8:1145407-1145429 CCTGGCTGAGCTGGTGTGTGGTG No data
Right 1035636107 8:1145447-1145469 CACTGTGGTCTCCCGTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035636107 Original CRISPR CACTGTGGTCTCCCGTCCTG TGG Intergenic
No off target data available for this crispr