ID: 1035636108

View in Genome Browser
Species Human (GRCh38)
Location 8:1145448-1145470
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035636100_1035636108 27 Left 1035636100 8:1145398-1145420 CCTGGGAGACCTGGCTGAGCTGG No data
Right 1035636108 8:1145448-1145470 ACTGTGGTCTCCCGTCCTGTGGG No data
1035636103_1035636108 18 Left 1035636103 8:1145407-1145429 CCTGGCTGAGCTGGTGTGTGGTG No data
Right 1035636108 8:1145448-1145470 ACTGTGGTCTCCCGTCCTGTGGG No data
1035636104_1035636108 -6 Left 1035636104 8:1145431-1145453 CCTCTGTACATGACTCCACTGTG No data
Right 1035636108 8:1145448-1145470 ACTGTGGTCTCCCGTCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035636108 Original CRISPR ACTGTGGTCTCCCGTCCTGT GGG Intergenic