ID: 1035636197

View in Genome Browser
Species Human (GRCh38)
Location 8:1146109-1146131
Sequence TGGCAGGCGCCCTCCTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035636197_1035636202 -1 Left 1035636197 8:1146109-1146131 CCAGGCCAGGAGGGCGCCTGCCA No data
Right 1035636202 8:1146131-1146153 ACACATCTCTGCAGCCACGAGGG No data
1035636197_1035636206 29 Left 1035636197 8:1146109-1146131 CCAGGCCAGGAGGGCGCCTGCCA No data
Right 1035636206 8:1146161-1146183 CTCTCCACAGGAGCCCCTGCAGG No data
1035636197_1035636201 -2 Left 1035636197 8:1146109-1146131 CCAGGCCAGGAGGGCGCCTGCCA No data
Right 1035636201 8:1146130-1146152 CACACATCTCTGCAGCCACGAGG No data
1035636197_1035636204 17 Left 1035636197 8:1146109-1146131 CCAGGCCAGGAGGGCGCCTGCCA No data
Right 1035636204 8:1146149-1146171 GAGGGTGTCAGCCTCTCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035636197 Original CRISPR TGGCAGGCGCCCTCCTGGCC TGG (reversed) Intergenic