ID: 1035636199

View in Genome Browser
Species Human (GRCh38)
Location 8:1146125-1146147
Sequence TGGCTGCAGAGATGTGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035636199_1035636204 1 Left 1035636199 8:1146125-1146147 CCTGCCACACATCTCTGCAGCCA No data
Right 1035636204 8:1146149-1146171 GAGGGTGTCAGCCTCTCCACAGG No data
1035636199_1035636206 13 Left 1035636199 8:1146125-1146147 CCTGCCACACATCTCTGCAGCCA No data
Right 1035636206 8:1146161-1146183 CTCTCCACAGGAGCCCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035636199 Original CRISPR TGGCTGCAGAGATGTGTGGC AGG (reversed) Intergenic