ID: 1035636200

View in Genome Browser
Species Human (GRCh38)
Location 8:1146129-1146151
Sequence CTCGTGGCTGCAGAGATGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035636200_1035636206 9 Left 1035636200 8:1146129-1146151 CCACACATCTCTGCAGCCACGAG No data
Right 1035636206 8:1146161-1146183 CTCTCCACAGGAGCCCCTGCAGG No data
1035636200_1035636204 -3 Left 1035636200 8:1146129-1146151 CCACACATCTCTGCAGCCACGAG No data
Right 1035636204 8:1146149-1146171 GAGGGTGTCAGCCTCTCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035636200 Original CRISPR CTCGTGGCTGCAGAGATGTG TGG (reversed) Intergenic