ID: 1035636203

View in Genome Browser
Species Human (GRCh38)
Location 8:1146145-1146167
Sequence TGGAGAGGCTGACACCCTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035636203_1035636211 17 Left 1035636203 8:1146145-1146167 CCACGAGGGTGTCAGCCTCTCCA No data
Right 1035636211 8:1146185-1146207 GCTGTGACAGCATCTTGTCATGG No data
1035636203_1035636206 -7 Left 1035636203 8:1146145-1146167 CCACGAGGGTGTCAGCCTCTCCA No data
Right 1035636206 8:1146161-1146183 CTCTCCACAGGAGCCCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035636203 Original CRISPR TGGAGAGGCTGACACCCTCG TGG (reversed) Intergenic