ID: 1035636206

View in Genome Browser
Species Human (GRCh38)
Location 8:1146161-1146183
Sequence CTCTCCACAGGAGCCCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035636197_1035636206 29 Left 1035636197 8:1146109-1146131 CCAGGCCAGGAGGGCGCCTGCCA No data
Right 1035636206 8:1146161-1146183 CTCTCCACAGGAGCCCCTGCAGG No data
1035636203_1035636206 -7 Left 1035636203 8:1146145-1146167 CCACGAGGGTGTCAGCCTCTCCA No data
Right 1035636206 8:1146161-1146183 CTCTCCACAGGAGCCCCTGCAGG No data
1035636200_1035636206 9 Left 1035636200 8:1146129-1146151 CCACACATCTCTGCAGCCACGAG No data
Right 1035636206 8:1146161-1146183 CTCTCCACAGGAGCCCCTGCAGG No data
1035636198_1035636206 24 Left 1035636198 8:1146114-1146136 CCAGGAGGGCGCCTGCCACACAT No data
Right 1035636206 8:1146161-1146183 CTCTCCACAGGAGCCCCTGCAGG No data
1035636199_1035636206 13 Left 1035636199 8:1146125-1146147 CCTGCCACACATCTCTGCAGCCA No data
Right 1035636206 8:1146161-1146183 CTCTCCACAGGAGCCCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035636206 Original CRISPR CTCTCCACAGGAGCCCCTGC AGG Intergenic