ID: 1035640992

View in Genome Browser
Species Human (GRCh38)
Location 8:1185020-1185042
Sequence CTTCACCATCCCCCGTCCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035640992_1035640998 9 Left 1035640992 8:1185020-1185042 CCGGGGGACGGGGGATGGTGAAG No data
Right 1035640998 8:1185052-1185074 TCCCAGGAAAGGTCGGGCGAGGG No data
1035640992_1035640995 2 Left 1035640992 8:1185020-1185042 CCGGGGGACGGGGGATGGTGAAG No data
Right 1035640995 8:1185045-1185067 ACTCGTTTCCCAGGAAAGGTCGG No data
1035640992_1035641001 24 Left 1035640992 8:1185020-1185042 CCGGGGGACGGGGGATGGTGAAG No data
Right 1035641001 8:1185067-1185089 GGCGAGGGTTCTGCGTCTTGCGG No data
1035640992_1035640994 -2 Left 1035640992 8:1185020-1185042 CCGGGGGACGGGGGATGGTGAAG No data
Right 1035640994 8:1185041-1185063 AGTGACTCGTTTCCCAGGAAAGG No data
1035640992_1035640993 -7 Left 1035640992 8:1185020-1185042 CCGGGGGACGGGGGATGGTGAAG No data
Right 1035640993 8:1185036-1185058 GGTGAAGTGACTCGTTTCCCAGG No data
1035640992_1035640997 8 Left 1035640992 8:1185020-1185042 CCGGGGGACGGGGGATGGTGAAG No data
Right 1035640997 8:1185051-1185073 TTCCCAGGAAAGGTCGGGCGAGG No data
1035640992_1035640996 3 Left 1035640992 8:1185020-1185042 CCGGGGGACGGGGGATGGTGAAG No data
Right 1035640996 8:1185046-1185068 CTCGTTTCCCAGGAAAGGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035640992 Original CRISPR CTTCACCATCCCCCGTCCCC CGG (reversed) Intergenic
No off target data available for this crispr