ID: 1035640994

View in Genome Browser
Species Human (GRCh38)
Location 8:1185041-1185063
Sequence AGTGACTCGTTTCCCAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035640992_1035640994 -2 Left 1035640992 8:1185020-1185042 CCGGGGGACGGGGGATGGTGAAG No data
Right 1035640994 8:1185041-1185063 AGTGACTCGTTTCCCAGGAAAGG No data
1035640991_1035640994 -1 Left 1035640991 8:1185019-1185041 CCCGGGGGACGGGGGATGGTGAA No data
Right 1035640994 8:1185041-1185063 AGTGACTCGTTTCCCAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035640994 Original CRISPR AGTGACTCGTTTCCCAGGAA AGG Intergenic
No off target data available for this crispr