ID: 1035641617

View in Genome Browser
Species Human (GRCh38)
Location 8:1188874-1188896
Sequence GTGGCATCATATATATTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035641617_1035641623 11 Left 1035641617 8:1188874-1188896 CCTCCAAATATATATGATGCCAC No data
Right 1035641623 8:1188908-1188930 ACACAGGTTGCCTTGTGGTGCGG No data
1035641617_1035641621 6 Left 1035641617 8:1188874-1188896 CCTCCAAATATATATGATGCCAC No data
Right 1035641621 8:1188903-1188925 TCCTCACACAGGTTGCCTTGTGG No data
1035641617_1035641624 19 Left 1035641617 8:1188874-1188896 CCTCCAAATATATATGATGCCAC No data
Right 1035641624 8:1188916-1188938 TGCCTTGTGGTGCGGCTTCCAGG No data
1035641617_1035641619 -5 Left 1035641617 8:1188874-1188896 CCTCCAAATATATATGATGCCAC No data
Right 1035641619 8:1188892-1188914 GCCACATCTTCTCCTCACACAGG No data
1035641617_1035641626 23 Left 1035641617 8:1188874-1188896 CCTCCAAATATATATGATGCCAC No data
Right 1035641626 8:1188920-1188942 TTGTGGTGCGGCTTCCAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035641617 Original CRISPR GTGGCATCATATATATTTGG AGG (reversed) Intergenic
No off target data available for this crispr