ID: 1035641992

View in Genome Browser
Species Human (GRCh38)
Location 8:1190917-1190939
Sequence CTCCTATGGAAGCCGTCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035641989_1035641992 14 Left 1035641989 8:1190880-1190902 CCGTTCAGTGCACGGGGCGTGTT No data
Right 1035641992 8:1190917-1190939 CTCCTATGGAAGCCGTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035641992 Original CRISPR CTCCTATGGAAGCCGTCCCA TGG Intergenic
No off target data available for this crispr