ID: 1035643690

View in Genome Browser
Species Human (GRCh38)
Location 8:1202381-1202403
Sequence GTGGACGTCCATGCTGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035643683_1035643690 27 Left 1035643683 8:1202331-1202353 CCTGGGCCAGGGGCAGGCACGGC No data
Right 1035643690 8:1202381-1202403 GTGGACGTCCATGCTGTTGTGGG No data
1035643684_1035643690 21 Left 1035643684 8:1202337-1202359 CCAGGGGCAGGCACGGCTCCTCT No data
Right 1035643690 8:1202381-1202403 GTGGACGTCCATGCTGTTGTGGG No data
1035643688_1035643690 -7 Left 1035643688 8:1202365-1202387 CCTGTTGTGCTGTGCAGTGGACG No data
Right 1035643690 8:1202381-1202403 GTGGACGTCCATGCTGTTGTGGG No data
1035643686_1035643690 3 Left 1035643686 8:1202355-1202377 CCTCTTGGCACCTGTTGTGCTGT No data
Right 1035643690 8:1202381-1202403 GTGGACGTCCATGCTGTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035643690 Original CRISPR GTGGACGTCCATGCTGTTGT GGG Intergenic