ID: 1035645204

View in Genome Browser
Species Human (GRCh38)
Location 8:1213815-1213837
Sequence GCTGCCTCCTGACCTGGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035645199_1035645204 -5 Left 1035645199 8:1213797-1213819 CCATTGTGCTCAGCCACCGCTGC No data
Right 1035645204 8:1213815-1213837 GCTGCCTCCTGACCTGGTCTGGG No data
1035645198_1035645204 1 Left 1035645198 8:1213791-1213813 CCATGGCCATTGTGCTCAGCCAC No data
Right 1035645204 8:1213815-1213837 GCTGCCTCCTGACCTGGTCTGGG No data
1035645194_1035645204 19 Left 1035645194 8:1213773-1213795 CCATCTTTCCAGTGGCTCCCATG No data
Right 1035645204 8:1213815-1213837 GCTGCCTCCTGACCTGGTCTGGG No data
1035645196_1035645204 11 Left 1035645196 8:1213781-1213803 CCAGTGGCTCCCATGGCCATTGT No data
Right 1035645204 8:1213815-1213837 GCTGCCTCCTGACCTGGTCTGGG No data
1035645197_1035645204 2 Left 1035645197 8:1213790-1213812 CCCATGGCCATTGTGCTCAGCCA No data
Right 1035645204 8:1213815-1213837 GCTGCCTCCTGACCTGGTCTGGG No data
1035645193_1035645204 26 Left 1035645193 8:1213766-1213788 CCAGCATCCATCTTTCCAGTGGC No data
Right 1035645204 8:1213815-1213837 GCTGCCTCCTGACCTGGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035645204 Original CRISPR GCTGCCTCCTGACCTGGTCT GGG Intergenic
No off target data available for this crispr