ID: 1035647093

View in Genome Browser
Species Human (GRCh38)
Location 8:1232919-1232941
Sequence GGGTGGGCCTAGAATGGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035647093_1035647097 -7 Left 1035647093 8:1232919-1232941 CCACTCCCATTCTAGGCCCACCC No data
Right 1035647097 8:1232935-1232957 CCCACCCCCTGCCCAGCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035647093 Original CRISPR GGGTGGGCCTAGAATGGGAG TGG (reversed) Intergenic
No off target data available for this crispr