ID: 1035649361

View in Genome Browser
Species Human (GRCh38)
Location 8:1253309-1253331
Sequence GCCAGGGCCCCTTTATCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035649349_1035649361 16 Left 1035649349 8:1253270-1253292 CCTGTGTGTGCCCTTTCTTCCCG No data
Right 1035649361 8:1253309-1253331 GCCAGGGCCCCTTTATCTCCCGG No data
1035649355_1035649361 5 Left 1035649355 8:1253281-1253303 CCTTTCTTCCCGGGGCTCCAGGA No data
Right 1035649361 8:1253309-1253331 GCCAGGGCCCCTTTATCTCCCGG No data
1035649353_1035649361 6 Left 1035649353 8:1253280-1253302 CCCTTTCTTCCCGGGGCTCCAGG No data
Right 1035649361 8:1253309-1253331 GCCAGGGCCCCTTTATCTCCCGG No data
1035649348_1035649361 29 Left 1035649348 8:1253257-1253279 CCGCTGGGTGGTTCCTGTGTGTG No data
Right 1035649361 8:1253309-1253331 GCCAGGGCCCCTTTATCTCCCGG No data
1035649356_1035649361 -3 Left 1035649356 8:1253289-1253311 CCCGGGGCTCCAGGAGAGCTGCC No data
Right 1035649361 8:1253309-1253331 GCCAGGGCCCCTTTATCTCCCGG No data
1035649357_1035649361 -4 Left 1035649357 8:1253290-1253312 CCGGGGCTCCAGGAGAGCTGCCA No data
Right 1035649361 8:1253309-1253331 GCCAGGGCCCCTTTATCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035649361 Original CRISPR GCCAGGGCCCCTTTATCTCC CGG Intergenic
No off target data available for this crispr