ID: 1035650273

View in Genome Browser
Species Human (GRCh38)
Location 8:1258697-1258719
Sequence AGCTGGCTTTGTTTATGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035650266_1035650273 22 Left 1035650266 8:1258652-1258674 CCAAGGGTAGCTTTTGAAGTAAA No data
Right 1035650273 8:1258697-1258719 AGCTGGCTTTGTTTATGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035650273 Original CRISPR AGCTGGCTTTGTTTATGGAA GGG Intergenic