ID: 1035650544

View in Genome Browser
Species Human (GRCh38)
Location 8:1260824-1260846
Sequence CAGAGCATGGGGAGGTGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035650537_1035650544 18 Left 1035650537 8:1260783-1260805 CCTTGGCTGGCGCAGGCTGACTT No data
Right 1035650544 8:1260824-1260846 CAGAGCATGGGGAGGTGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035650544 Original CRISPR CAGAGCATGGGGAGGTGATC TGG Intergenic
No off target data available for this crispr