ID: 1035651650

View in Genome Browser
Species Human (GRCh38)
Location 8:1270237-1270259
Sequence CCGTATACACAGAAGGGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035651646_1035651650 13 Left 1035651646 8:1270201-1270223 CCAACAGCATGGGATTGAGAATA No data
Right 1035651650 8:1270237-1270259 CCGTATACACAGAAGGGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035651650 Original CRISPR CCGTATACACAGAAGGGACT TGG Intergenic
No off target data available for this crispr