ID: 1035654709

View in Genome Browser
Species Human (GRCh38)
Location 8:1296824-1296846
Sequence GCACTGTCCTGTGTGGTTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035654709_1035654720 12 Left 1035654709 8:1296824-1296846 CCCCGAACCACACAGGACAGTGC No data
Right 1035654720 8:1296859-1296881 GTTTCATGCGGGGCTCAGAAAGG No data
1035654709_1035654721 16 Left 1035654709 8:1296824-1296846 CCCCGAACCACACAGGACAGTGC No data
Right 1035654721 8:1296863-1296885 CATGCGGGGCTCAGAAAGGCCGG No data
1035654709_1035654718 1 Left 1035654709 8:1296824-1296846 CCCCGAACCACACAGGACAGTGC No data
Right 1035654718 8:1296848-1296870 GCGGAGGGGATGTTTCATGCGGG No data
1035654709_1035654723 21 Left 1035654709 8:1296824-1296846 CCCCGAACCACACAGGACAGTGC No data
Right 1035654723 8:1296868-1296890 GGGGCTCAGAAAGGCCGGGCTGG No data
1035654709_1035654722 17 Left 1035654709 8:1296824-1296846 CCCCGAACCACACAGGACAGTGC No data
Right 1035654722 8:1296864-1296886 ATGCGGGGCTCAGAAAGGCCGGG No data
1035654709_1035654719 2 Left 1035654709 8:1296824-1296846 CCCCGAACCACACAGGACAGTGC No data
Right 1035654719 8:1296849-1296871 CGGAGGGGATGTTTCATGCGGGG No data
1035654709_1035654717 0 Left 1035654709 8:1296824-1296846 CCCCGAACCACACAGGACAGTGC No data
Right 1035654717 8:1296847-1296869 TGCGGAGGGGATGTTTCATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035654709 Original CRISPR GCACTGTCCTGTGTGGTTCG GGG (reversed) Intergenic
No off target data available for this crispr