ID: 1035655380

View in Genome Browser
Species Human (GRCh38)
Location 8:1301281-1301303
Sequence AGACAGCAGCTTCCATGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 244}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035655380_1035655386 2 Left 1035655380 8:1301281-1301303 CCCTTCCATGGAAGCTGCTGTCT 0: 1
1: 0
2: 2
3: 21
4: 244
Right 1035655386 8:1301306-1301328 TCCATGAGAGGCCTCTGCCTGGG 0: 1
1: 0
2: 0
3: 17
4: 188
1035655380_1035655383 -10 Left 1035655380 8:1301281-1301303 CCCTTCCATGGAAGCTGCTGTCT 0: 1
1: 0
2: 2
3: 21
4: 244
Right 1035655383 8:1301294-1301316 GCTGCTGTCTCCTCCATGAGAGG 0: 1
1: 0
2: 2
3: 17
4: 191
1035655380_1035655391 22 Left 1035655380 8:1301281-1301303 CCCTTCCATGGAAGCTGCTGTCT 0: 1
1: 0
2: 2
3: 21
4: 244
Right 1035655391 8:1301326-1301348 GGGCATCATGCTCGAGCTCCGGG 0: 1
1: 0
2: 0
3: 5
4: 91
1035655380_1035655392 23 Left 1035655380 8:1301281-1301303 CCCTTCCATGGAAGCTGCTGTCT 0: 1
1: 0
2: 2
3: 21
4: 244
Right 1035655392 8:1301327-1301349 GGCATCATGCTCGAGCTCCGGGG 0: 1
1: 0
2: 0
3: 0
4: 36
1035655380_1035655385 1 Left 1035655380 8:1301281-1301303 CCCTTCCATGGAAGCTGCTGTCT 0: 1
1: 0
2: 2
3: 21
4: 244
Right 1035655385 8:1301305-1301327 CTCCATGAGAGGCCTCTGCCTGG 0: 1
1: 0
2: 2
3: 15
4: 234
1035655380_1035655390 21 Left 1035655380 8:1301281-1301303 CCCTTCCATGGAAGCTGCTGTCT 0: 1
1: 0
2: 2
3: 21
4: 244
Right 1035655390 8:1301325-1301347 TGGGCATCATGCTCGAGCTCCGG 0: 1
1: 0
2: 0
3: 35
4: 651
1035655380_1035655393 29 Left 1035655380 8:1301281-1301303 CCCTTCCATGGAAGCTGCTGTCT 0: 1
1: 0
2: 2
3: 21
4: 244
Right 1035655393 8:1301333-1301355 ATGCTCGAGCTCCGGGGCCTAGG 0: 1
1: 0
2: 0
3: 5
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035655380 Original CRISPR AGACAGCAGCTTCCATGGAA GGG (reversed) Intergenic
900932076 1:5743834-5743856 ACACAGCAGATCTCATGGAAGGG - Intergenic
900963442 1:5940454-5940476 AGACAGGAGCAACCAGGGAAAGG + Intronic
902047925 1:13539847-13539869 AGATAGTAGTTTCCATGGAGTGG + Intergenic
902140592 1:14350459-14350481 GGACAGTAGTTACCATGGAAGGG + Intergenic
904172432 1:28600774-28600796 ACACAGCAGCCTCCAAGGCATGG + Intronic
904352325 1:29916705-29916727 AGACAGAAACTTCTATGAAAAGG + Intergenic
904998329 1:34648535-34648557 AGACAGCATCTCCCTTGCAAGGG + Intergenic
905851911 1:41280915-41280937 ACACTGCAGCTTCCGTGGAGTGG - Intergenic
909504432 1:76372170-76372192 AGACAGCAGCTTTCAAGTGATGG + Intronic
913192630 1:116426431-116426453 AGACAGCAGATGCCATGGTGAGG + Intergenic
913296609 1:117327563-117327585 CAACATCAGCTTCCATGAAATGG - Intergenic
913459793 1:119072242-119072264 AGACATCAGCTTCTTTAGAATGG - Intronic
913571278 1:120122402-120122424 AGACAGCAGGTTCAGTGCAACGG + Intergenic
914292089 1:146283379-146283401 AGACAGCAGGTTCAGTGCAACGG + Intergenic
914553133 1:148734162-148734184 AGACAGCAGGTTCAGTGCAACGG + Intergenic
916582118 1:166118180-166118202 AGACAGGAGCTTGGATGGAGTGG + Intronic
916910352 1:169339940-169339962 AGAGAGCAGCTGTAATGGAAAGG - Intronic
917008905 1:170448936-170448958 AGACAAAGGCTTCCTTGGAAAGG + Intergenic
917613943 1:176717562-176717584 AGACAGCAGCTTTTATGAAGAGG - Intronic
917810246 1:178651447-178651469 ACACAGCAGCTGCCGTGCAAAGG - Intergenic
918239215 1:182606999-182607021 AGACTTCTGCCTCCATGGAAAGG - Intergenic
919355134 1:196512471-196512493 TGACATCAGCTAACATGGAAAGG - Intronic
920687096 1:208117598-208117620 TGACAGCTGCAGCCATGGAATGG + Intronic
921803925 1:219432905-219432927 ATACAACAGGTTCCATGAAATGG + Intergenic
922033644 1:221827396-221827418 AGACAACAGTTTCCTGGGAAAGG - Intergenic
922360785 1:224819477-224819499 AGACAGGTGGTTCCATGGCAGGG + Intergenic
922861434 1:228820038-228820060 AGACACAAGCATCAATGGAACGG - Intergenic
922881313 1:228983326-228983348 ACAGAGCAGCCTCCATGGTAGGG + Intergenic
923508176 1:234624861-234624883 TGACAGCTACTTCCATGGAGTGG - Intergenic
923858842 1:237872575-237872597 AGGCAGGTGCTACCATGGAAAGG + Intergenic
924161904 1:241241522-241241544 TCAAAGCAGCTTCCTTGGAAAGG - Intronic
1064339281 10:14472226-14472248 AGACAGCAGCTGCAGTGGGAAGG + Intergenic
1067038623 10:42936464-42936486 AGAGACCAGCACCCATGGAAAGG + Intergenic
1067944680 10:50682459-50682481 AGACAGCAGCCTCAGGGGAAAGG + Intergenic
1069687837 10:70330480-70330502 AGACAGCAGGTTCCTGGGGATGG + Intronic
1070602960 10:77878480-77878502 AGACAGCAGATGCTATGGAAGGG + Intronic
1070866183 10:79709330-79709352 AGACAGCAGCCTCAGGGGAAAGG + Intronic
1070879977 10:79847461-79847483 AGACAGCAGCCTCAGGGGAAAGG + Intronic
1070959356 10:80488018-80488040 AGAAACCAGCTTCCACGGAGTGG - Intronic
1071633087 10:87231551-87231573 AGACAGCAGCCTCAGGGGAAAGG + Intronic
1071646536 10:87363769-87363791 AGACAGCAGCCTCAGGGGAAAGG + Intronic
1073251252 10:102121316-102121338 GGACAGCAGCTTCCAGGCAGGGG - Intergenic
1073817303 10:107222187-107222209 AAACAGCTGATTCCAGGGAAGGG - Intergenic
1075080381 10:119379569-119379591 GGACAGCAACTTGCAGGGAAGGG - Intronic
1076090627 10:127682455-127682477 AGAAAGTGGCTTCCATTGAATGG - Intergenic
1077656461 11:4023914-4023936 ACACAGCACCTTCCATGGTGAGG + Exonic
1078124012 11:8540715-8540737 AAACAGTAGCTACCATGGATGGG + Intronic
1079156465 11:17952760-17952782 AGAGAGCAGCTTCAGTGGGAAGG - Intronic
1082593705 11:55047581-55047603 AAACAGCTGAATCCATGGAAAGG + Intergenic
1083590703 11:63892293-63892315 AGCCTGCAGCTACCATGCAAAGG + Intronic
1084486717 11:69452419-69452441 AGGGAGCAGCTTCCAGGGAAAGG + Intergenic
1084783497 11:71427634-71427656 AAACTGCAGCTTCCAGGGAAAGG + Intergenic
1090352449 11:126115933-126115955 AGCCAGCAGCACCCATAGAATGG + Intergenic
1091685154 12:2556278-2556300 AGGGAGGAGGTTCCATGGAAAGG - Intronic
1093144497 12:15548901-15548923 ATAATGCTGCTTCCATGGAAGGG + Intronic
1094493404 12:30975345-30975367 AGGCAGCAGCTTCCACAGCAGGG - Intronic
1100661451 12:96703440-96703462 CACCAGCAGCTTCCATGGACAGG - Intronic
1101249137 12:102915080-102915102 AGAAAGCAGCTTGGCTGGAAAGG - Intronic
1102250623 12:111384647-111384669 TGCCAGCAGTTTCAATGGAAGGG - Intergenic
1102657900 12:114498565-114498587 AAACATCCGTTTCCATGGAAGGG + Intergenic
1103274726 12:119701711-119701733 ACACAGCAGGTGCCAAGGAATGG + Exonic
1104797814 12:131531840-131531862 AGACAGGTGTTTCCAAGGAAAGG - Intergenic
1105281066 13:18962860-18962882 CCACCCCAGCTTCCATGGAAGGG + Intergenic
1105934285 13:25084963-25084985 AGACAACTGCTACCAAGGAAGGG - Intergenic
1109743007 13:66580830-66580852 TGACATCAGCTTGCATGGATGGG - Intronic
1110028435 13:70572085-70572107 AGAAAGAATCTTCGATGGAATGG - Intergenic
1110646532 13:77892025-77892047 AGGCAGCAGCTTCCTTGGAAGGG - Intergenic
1117836626 14:59814486-59814508 AGCCAGCAGCTTCTCTGGAAAGG + Intronic
1118118756 14:62811776-62811798 TGACAGAAGCTTCGCTGGAAAGG + Intronic
1119971887 14:78980015-78980037 AAACCACAGCTTCCATGGGAAGG - Intronic
1121446292 14:93981213-93981235 AGGAAGGAGCATCCATGGAAGGG + Intergenic
1123570069 15:21595963-21595985 GGACAGCATCTTCAATGGGACGG + Intergenic
1123606181 15:22031283-22031305 GGACAGCATCTTCAATGGGACGG + Intergenic
1124447566 15:29751304-29751326 AGAAAGCAGATTACATGTAAAGG - Intronic
1124898988 15:33805165-33805187 TGACAGCAGCTTCCTCAGAAGGG + Intronic
1125208273 15:37180136-37180158 AGACAGCAGCTTAGTTGAAAGGG + Intergenic
1127762741 15:62154937-62154959 AAACAGCAACCTCCCTGGAAAGG - Intergenic
1129446843 15:75625095-75625117 AGGCAGCACCATCCAAGGAATGG - Intronic
1130145912 15:81273536-81273558 AGACAGGATCTTGGATGGAAAGG - Intronic
1132296617 15:100739647-100739669 AGACACCAGCAACTATGGAAAGG - Intergenic
1202978420 15_KI270727v1_random:323056-323078 GGACAGCATCTTCAATGGGACGG + Intergenic
1132903878 16:2272332-2272354 AGACAGCAGCTGCCCTGGCTGGG + Intergenic
1134514447 16:14875394-14875416 TGACAACGGCTTCCATTGAAGGG - Exonic
1134702123 16:16274047-16274069 TGACAACGGCTTCCATTGAAGGG - Exonic
1134767897 16:16777753-16777775 TGAAAGCAGCTTTCATGTAAAGG + Intergenic
1134969707 16:18520603-18520625 TGACAACGGCTTCCATTGAAGGG + Exonic
1135803968 16:25525307-25525329 ATACAGCAGCTTCTGAGGAACGG - Intergenic
1138301479 16:55933499-55933521 AGAGAGCAGATTCATTGGAAGGG - Intronic
1138573852 16:57893912-57893934 AGCCAGCACCTCACATGGAAGGG + Intronic
1138826762 16:60330085-60330107 AGACATCAGCTTGCATGGAGAGG - Intergenic
1139480236 16:67226681-67226703 AGACAGCCACTTCAAGGGAAGGG + Intronic
1139569754 16:67804229-67804251 TGACTGCAGCTACCTTGGAAAGG - Intronic
1143812813 17:9486240-9486262 AAACAGCAGATTCCAGGGATAGG + Intronic
1144509545 17:15864141-15864163 AGACAGAAGGTTACATGGTAAGG + Intergenic
1144711709 17:17405625-17405647 AGTTAGCAGCATCCAGGGAATGG + Intergenic
1144767382 17:17740079-17740101 AGACATCAGCATCCATTGAAGGG + Intronic
1144833633 17:18145189-18145211 AGGCAGGTGCTTCCATGGGAGGG + Intronic
1145173655 17:20681781-20681803 AGACAGAAGGTTACATGGTAAGG + Intergenic
1145844076 17:28022381-28022403 AAACAGCAGCTTCCTTGTCAGGG - Intergenic
1148350604 17:46939311-46939333 AGGTAGCTGCTTCCAGGGAATGG - Intronic
1149558693 17:57592930-57592952 GGAAAGCAGCTTCCATGGCCGGG + Intronic
1151815606 17:76470045-76470067 AGACAGCAGTTTCCAGAGAGTGG + Exonic
1153906994 18:9670514-9670536 AAACACCATTTTCCATGGAAAGG - Intergenic
1153917972 18:9762517-9762539 AGACAGGTGCTTCCTTGGATAGG + Intronic
1155106853 18:22675381-22675403 ACACAGCAAATTCCATGAAATGG - Intergenic
1155522679 18:26685057-26685079 ATTCACCAGCTTCCATGGAATGG - Intergenic
1155890322 18:31260471-31260493 AGAGAGCAGCTTCCAAGAAGAGG - Intergenic
1157351650 18:46893177-46893199 AGACAACAGCTTCTTGGGAAGGG + Intronic
1157999167 18:52596036-52596058 AGACTACAGCTTTTATGGAATGG + Intronic
1159657544 18:71050596-71050618 AGAAATCATCTTCAATGGAAAGG - Intergenic
1160005621 18:75067147-75067169 AGACAGCAGTTTCCAGAAAAAGG + Intergenic
1160686963 19:441410-441432 AGACAGCTGTTTCCATGAAAAGG + Intronic
1162732821 19:12729172-12729194 AGACTCCAGCCTCCCTGGAAGGG + Intergenic
1162947884 19:14054673-14054695 AGGCAGCAGCTTCCATAGAAGGG - Exonic
1163653489 19:18532232-18532254 AAACAGCCACTTCCATGGGATGG + Exonic
1165100277 19:33434979-33435001 AGACAGCAGCCTCCATGCCCAGG + Intronic
1166160525 19:40949358-40949380 AGACAACTGGTGCCATGGAAGGG - Intergenic
1168431744 19:56287071-56287093 AGACTCCAGAATCCATGGAATGG - Intronic
1168723698 19:58569464-58569486 ACCCAGCAACTTCCAGGGAAAGG + Intronic
926019795 2:9484983-9485005 AAAAAGCAGGTCCCATGGAATGG + Intronic
926956838 2:18311066-18311088 AGACAGCAGATTCCAGAGCAAGG + Intronic
927022747 2:19034273-19034295 TGGCAGCAGCCTCCATGAAATGG + Intergenic
928187260 2:29123238-29123260 AGAAAGCAGCTACGATGAAAAGG - Intronic
928746445 2:34421365-34421387 ATACATCAACTTCCATGCAAGGG - Intergenic
928904966 2:36357808-36357830 AGCCAGCACCGTCCAGGGAACGG + Intronic
929264493 2:39903096-39903118 AAAAAGCAGCTTCCATGGAGGGG + Intergenic
929380489 2:41344981-41345003 AAAAAGCAGCTTTCCTGGAAAGG - Intergenic
931877067 2:66525389-66525411 AGACTGCAGCTTGCATAGAAAGG + Intronic
932450835 2:71809765-71809787 TGACAGCAGCTTCATTAGAAAGG + Intergenic
933190652 2:79330016-79330038 AAACAGCTTCTTCCATGGAGAGG + Intronic
937319820 2:120954427-120954449 GGACGGCAGCTTCCATGGCCTGG + Intronic
937433499 2:121860841-121860863 AGACCCCAGCGTCCATGAAAAGG + Intergenic
940346807 2:152637055-152637077 AGAAAGCAGATTCAGTGGAAGGG + Intronic
940690326 2:156909852-156909874 AAACAGCAGCTCCCATTAAAAGG - Intergenic
942223651 2:173795713-173795735 AGAAAGCAGCTTTCTTGGCAGGG + Intergenic
944319507 2:198321841-198321863 AGACATCTTCTCCCATGGAAAGG - Intronic
944658355 2:201899174-201899196 AGGGAGCAGCTTCCATGGCATGG + Intergenic
945506103 2:210642051-210642073 AGACAGCAGATTAAGTGGAAAGG + Intronic
946458381 2:219848327-219848349 AGACAGCATTTTCCAGGGAAGGG + Intergenic
946683255 2:222240006-222240028 AGACGGCAGCTTCCGAGGGAAGG - Intronic
947288548 2:228545756-228545778 AGATAGCAACTCCCAGGGAAGGG + Intergenic
947779937 2:232750389-232750411 AGGGAGCAGCTGGCATGGAAAGG - Intronic
948338259 2:237228368-237228390 AGACAGCAGATTCCAAGGGCTGG + Intergenic
948497540 2:238361954-238361976 AGCCAGCGGCCTCCCTGGAATGG - Intronic
948807894 2:240460829-240460851 GGACAGCAGCTGCCATGGGCAGG - Intronic
1168731242 20:83203-83225 AGACACCAACTTTCCTGGAAAGG + Intergenic
1168997790 20:2145774-2145796 AGACAGCTGCCCCCAAGGAAAGG - Exonic
1169236235 20:3932123-3932145 AGCCACCATTTTCCATGGAATGG - Exonic
1169481836 20:5989691-5989713 AGACAGCAGCCTCCAGGGATGGG - Intronic
1170016004 20:11783048-11783070 AGAGAGAACCATCCATGGAAAGG + Intergenic
1170141762 20:13131984-13132006 AGAGAGCAGCTCCCACAGAAGGG + Intronic
1170710086 20:18782783-18782805 AGCCAGCTGCTTCCATTGATGGG + Intergenic
1172150998 20:32790259-32790281 AGGCAGCTGCTTCCAGGGATGGG + Intronic
1173138011 20:40457454-40457476 AGACAGGAGATTCCCTGGCAGGG + Intergenic
1174038391 20:47682395-47682417 CGGCAGCAGCTTCCTTGGATCGG - Intronic
1174051776 20:47771941-47771963 AGATGGCAGCTTCCAGGGCAGGG + Intronic
1174353075 20:49982039-49982061 AGAGAGCAGCTTCCAGGGATGGG - Intergenic
1174561685 20:51435026-51435048 AGACAGCATCTTCCTTATAAGGG - Intronic
1174748767 20:53090629-53090651 TGACAGCAGCTTGCTTGCAAGGG + Intronic
1175301125 20:57943457-57943479 AGGCAGCCGCTTCCCTGGGATGG - Intergenic
1175881640 20:62262795-62262817 TCAAAGCAGCTTCCATGAAATGG + Intronic
1182437013 22:30337319-30337341 AGCCAGCAGGTTCCCTGGCAAGG + Intronic
1182758445 22:32700306-32700328 GGACAGCAGCCTCCCTGGAAGGG + Intronic
1182775950 22:32831057-32831079 AAATAGCAGCTTCCATGGCTGGG + Intronic
1184556251 22:45234587-45234609 ACACAGCAGCCTCCAAGAAATGG + Intronic
950018291 3:9769304-9769326 ATACAGGAGCTTCCAGGGGATGG - Intronic
951422114 3:22499044-22499066 AGACAGCAGCTGCAATGGTCTGG + Intergenic
951606639 3:24441864-24441886 AGCCAGCAACTTACAGGGAAGGG - Intronic
953061998 3:39435028-39435050 AGATAGCAGCCTCCTTGGATGGG - Intergenic
953492069 3:43361025-43361047 AGACAGCTGGTCCCAGGGAATGG - Intronic
953874602 3:46659435-46659457 TGACTGCAGCCTCCATGGACTGG - Intergenic
954762081 3:52882272-52882294 AGACTGCAGCTTCCATCTTAAGG - Intronic
958657117 3:97017246-97017268 ACACAGCCACTTCCAGGGAATGG - Intronic
959946848 3:112134118-112134140 AGACAGCAGACTTCAGGGAAAGG + Intergenic
961080093 3:124019302-124019324 GGACTGCAGCTTCTTTGGAAAGG - Intergenic
962533165 3:136302297-136302319 AGACTGCAACTTCCAGGGGAAGG - Intronic
963267931 3:143257695-143257717 AGCCAGCAGCTTCCAGATAATGG + Intergenic
968538449 4:1149953-1149975 GGACAGCAGCATCCGTGGGAAGG + Intergenic
968554725 4:1241081-1241103 AGACAGCAGATGCCACGGACAGG + Intronic
969155512 4:5206309-5206331 AGGCAGTGGCTTCCATGGGAGGG + Intronic
969571864 4:8013781-8013803 AGAGAGATGCTTCCAGGGAAAGG + Intronic
970602408 4:17650706-17650728 AGTTAGCAGCTACCCTGGAATGG - Intronic
971642723 4:29156640-29156662 AGACAGCATCATCCAGAGAATGG - Intergenic
971975695 4:33683454-33683476 AAACAGCATCTTTAATGGAACGG - Intergenic
972139085 4:35933898-35933920 TGACAGCTGCTTTCATTGAAAGG + Intergenic
973660524 4:53101065-53101087 GCACTGCAGCTTCCATGGACAGG + Intronic
973927324 4:55751900-55751922 AGACAACAGCTACCATGGTTTGG + Intergenic
977869774 4:102077833-102077855 TGACACCAGATTCCATGGAGTGG - Intergenic
980221157 4:129917741-129917763 AGCCAGCATCATGCATGGAAGGG - Intergenic
980602786 4:135046457-135046479 AGTCAGCTGCTTCCATTGATGGG - Intergenic
983922347 4:173359476-173359498 AGAACAAAGCTTCCATGGAAGGG - Intergenic
984288451 4:177763098-177763120 AGACAGCACCTCCAATGTAAAGG - Intronic
985231345 4:187821301-187821323 ACACAGCAGCTTTCAGGGGATGG - Intergenic
985587102 5:746139-746161 AGCCACGAGCTTCCATGGAGGGG + Intronic
985601673 5:838322-838344 AGCCACGAGCTTCCATGGAGGGG + Intronic
990873771 5:60462103-60462125 AGACTGCTGGTTCCATGGAGAGG - Intronic
991551502 5:67841852-67841874 AAACAGCAGCTTCCTTGCCATGG - Intergenic
995376941 5:111484381-111484403 AGGCAGCAGCTCCCAGAGAAGGG + Exonic
996827672 5:127703654-127703676 AGACAGCAGCTTTCAAAGAAAGG - Intergenic
997226224 5:132211348-132211370 AGAAAGCAGATACCATGGAGGGG + Intronic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
1002018911 5:176349266-176349288 AGACAGAAGCTTCCAGAGAGGGG - Intronic
1002093075 5:176816212-176816234 AGACATCAGCTGCCCTGGCAGGG + Intronic
1002924055 6:1594735-1594757 AGAGACCAGCTTCCATGGCGAGG - Intergenic
1002945981 6:1761086-1761108 GGACAGGCCCTTCCATGGAAGGG - Intronic
1004349291 6:14877086-14877108 GGACAGCAGCCTCCAGGGCAAGG + Intergenic
1006045087 6:31288248-31288270 AGACAGCAGGTCCCATACAATGG - Intronic
1007850394 6:44797426-44797448 AGAAAGCAGCTTCCATCTTATGG - Intergenic
1008099977 6:47379924-47379946 AGACAGGACCAACCATGGAAGGG + Intergenic
1009632569 6:66217164-66217186 ATATAGCAGCTTCCAAGGGAAGG + Intergenic
1009774418 6:68187157-68187179 AGAGAGCAGCTTGCAGGGCAGGG + Intergenic
1010037438 6:71342556-71342578 GGACAGCAGGATCCTTGGAAGGG - Intergenic
1011490855 6:87890382-87890404 AGACAGCACCTTCTGTGTAAAGG + Intergenic
1011508779 6:88077447-88077469 ACAAAGCAGCTTCCTTTGAAGGG + Intergenic
1013227147 6:108128045-108128067 AAACAGCAGTTCCCATGGAAGGG - Intronic
1013313598 6:108920512-108920534 AGACAGCTCCTTCCTAGGAAAGG - Intronic
1016128718 6:140438413-140438435 AGAGAGAAGCTTCCAAGAAAAGG + Intergenic
1017567656 6:155705487-155705509 TGATAGCAGCTCACATGGAATGG - Intergenic
1018043561 6:159946222-159946244 AGAGAGCAGCTGCAAAGGAAAGG - Intergenic
1018278361 6:162157279-162157301 AGCCAGGAGCTAGCATGGAAGGG - Intronic
1019659416 7:2215685-2215707 ACACAGCACCTTCCCTGGCAGGG - Intronic
1021865122 7:24948585-24948607 AGACATCCTCTTCCATAGAATGG - Intronic
1024673868 7:51620844-51620866 AGTCACCAGCTTCCTTGGAAAGG + Intergenic
1028922420 7:96322343-96322365 AGCCAGCAGCTTCCCTGGTGGGG - Intergenic
1029215222 7:98943336-98943358 AGACAGCAGCTGCCAAGGACAGG - Intronic
1029293678 7:99522291-99522313 AGGCAGCAGTTTCCGTGGAGTGG + Intronic
1032541769 7:132708753-132708775 AGACAGCTGCTGGCATGGCAGGG + Intronic
1033894863 7:146057113-146057135 AGACAGCATCCTCCAGGGCAAGG - Intergenic
1033903880 7:146177042-146177064 AGACAACAGAATCCATGGCAAGG - Intronic
1034831202 7:154309447-154309469 AAACAACAGATTCCATAGAACGG + Intronic
1035655380 8:1301281-1301303 AGACAGCAGCTTCCATGGAAGGG - Intergenic
1035993167 8:4515099-4515121 TTACAGCAGCTCCCTTGGAAAGG + Intronic
1037124871 8:15335627-15335649 AAACAGCAGCTTTGATTGAAGGG - Intergenic
1037818383 8:22123910-22123932 AAGGAGCAGCTTCCATGGAGAGG + Intronic
1039124484 8:34185839-34185861 AGACATCTGGTTCCAAGGAAAGG + Intergenic
1040839538 8:51770563-51770585 AGACAGCAGGAGACATGGAAAGG - Intronic
1040843488 8:51809469-51809491 GGAAAGCAGCTCCCAGGGAAAGG + Intergenic
1041526503 8:58812440-58812462 AGACAGCAGCAGCCAGGAAAGGG - Intronic
1041870657 8:62631050-62631072 AGAGAGCAGCTCCATTGGAATGG - Intronic
1041881169 8:62751177-62751199 AGGCAGCGGCCTGCATGGAATGG + Intronic
1043239451 8:77914764-77914786 AGTTATCAGCTTCCATGTAAGGG + Intergenic
1043399330 8:79868315-79868337 AGACAGCAGGAGCTATGGAATGG - Intergenic
1044274448 8:90284064-90284086 CCACAGCAGCATCCAGGGAAGGG - Intergenic
1045574296 8:103402851-103402873 AGACCACAGCTTCCAAGGAATGG + Intronic
1046841159 8:118858601-118858623 AGGCAGGAGCTTGCTTGGAAAGG - Intergenic
1048341447 8:133542220-133542242 AAACACCATTTTCCATGGAAAGG + Intronic
1049042504 8:140123366-140123388 AGGCAGCAGGTGCCAGGGAAGGG - Intronic
1049205354 8:141361066-141361088 AGACAGCAGACTCCATGGCGGGG + Intronic
1052762441 9:32606389-32606411 AGACAGCAGCTTCCATCTGAGGG + Intergenic
1053370704 9:37559350-37559372 AGACAGCTGCTTCACTGAAAGGG - Intronic
1054834654 9:69664063-69664085 AGACTGCAGATTTCATGAAAAGG + Intronic
1056010064 9:82319457-82319479 AGACAGAAGATTCAATAGAAGGG - Intergenic
1056790368 9:89621449-89621471 AGATGTCAGCCTCCATGGAAAGG - Intergenic
1057029114 9:91760183-91760205 AGAAAACACCTTCCATGGAGGGG - Intronic
1062226865 9:135457277-135457299 AGAGAGCAGCAGCCCTGGAATGG - Intergenic
1062583025 9:137236703-137236725 GGACAGAAGCTCCCAAGGAATGG + Intergenic
1185589114 X:1262122-1262144 GGACATCAGCTTTCGTGGAAGGG - Intergenic
1186468668 X:9804321-9804343 AGACAACAGCTTGGATGCAACGG + Intronic
1188030924 X:25262970-25262992 CCACAGCAGCTTCCAGGTAATGG - Intergenic
1190011659 X:46790528-46790550 AGACAACACCTGCAATGGAAAGG + Intergenic
1194093840 X:89611174-89611196 AGACAGAACCTTCTCTGGAATGG - Intergenic
1195645661 X:107228258-107228280 AGAGAGCAGCTTCAGTGGCATGG + Intronic
1198878519 X:141253373-141253395 AGAGAGCAGCTTCCTTGGGCCGG + Intergenic
1199087034 X:143639544-143639566 AGACAGTAGCTACTATTGAATGG - Intergenic
1200060677 X:153482443-153482465 AGGCAGCAGCTTCCGTGGTGCGG + Intronic
1200171972 X:154083624-154083646 GGTCAGGAGCTTACATGGAATGG - Intronic
1200446464 Y:3267307-3267329 AGACAGAACCTTCTCTGGAATGG - Intergenic
1200789071 Y:7283671-7283693 ATGCAGCAGGGTCCATGGAAAGG + Intergenic