ID: 1035656527

View in Genome Browser
Species Human (GRCh38)
Location 8:1311433-1311455
Sequence CTCAGCTACCACGGTAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035656527_1035656529 -9 Left 1035656527 8:1311433-1311455 CCAGCATTACCGTGGTAGCTGAG No data
Right 1035656529 8:1311447-1311469 GTAGCTGAGCCCGATAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035656527 Original CRISPR CTCAGCTACCACGGTAATGC TGG (reversed) Intergenic
No off target data available for this crispr