ID: 1035657251

View in Genome Browser
Species Human (GRCh38)
Location 8:1319460-1319482
Sequence CACCCTCGGAGAGATTGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035657245_1035657251 12 Left 1035657245 8:1319425-1319447 CCACTCACTCAGCCATCCTCTGT No data
Right 1035657251 8:1319460-1319482 CACCCTCGGAGAGATTGGAGTGG No data
1035657246_1035657251 0 Left 1035657246 8:1319437-1319459 CCATCCTCTGTCTTCCAGCTCTG No data
Right 1035657251 8:1319460-1319482 CACCCTCGGAGAGATTGGAGTGG No data
1035657247_1035657251 -4 Left 1035657247 8:1319441-1319463 CCTCTGTCTTCCAGCTCTGCACC No data
Right 1035657251 8:1319460-1319482 CACCCTCGGAGAGATTGGAGTGG No data
1035657244_1035657251 13 Left 1035657244 8:1319424-1319446 CCCACTCACTCAGCCATCCTCTG No data
Right 1035657251 8:1319460-1319482 CACCCTCGGAGAGATTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035657251 Original CRISPR CACCCTCGGAGAGATTGGAG TGG Intergenic
No off target data available for this crispr