ID: 1035660814

View in Genome Browser
Species Human (GRCh38)
Location 8:1346692-1346714
Sequence AACTCATGGTAGCTGTGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035660810_1035660814 -4 Left 1035660810 8:1346673-1346695 CCCATACAGAGCTGCTTTAAACT No data
Right 1035660814 8:1346692-1346714 AACTCATGGTAGCTGTGTGGAGG No data
1035660811_1035660814 -5 Left 1035660811 8:1346674-1346696 CCATACAGAGCTGCTTTAAACTC No data
Right 1035660814 8:1346692-1346714 AACTCATGGTAGCTGTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035660814 Original CRISPR AACTCATGGTAGCTGTGTGG AGG Intergenic
No off target data available for this crispr