ID: 1035660821

View in Genome Browser
Species Human (GRCh38)
Location 8:1346790-1346812
Sequence AACTCATGGTAGATGTGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035660818_1035660821 -4 Left 1035660818 8:1346771-1346793 CCTATACAGAACTGCTTTGAACT No data
Right 1035660821 8:1346790-1346812 AACTCATGGTAGATGTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035660821 Original CRISPR AACTCATGGTAGATGTGTGG AGG Intergenic
No off target data available for this crispr