ID: 1035662096

View in Genome Browser
Species Human (GRCh38)
Location 8:1356008-1356030
Sequence CCGATCATGCAAGGCAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035662096_1035662106 3 Left 1035662096 8:1356008-1356030 CCCTCCCTGCCTTGCATGATCGG No data
Right 1035662106 8:1356034-1356056 CACTGCACTGTCGGTCAGTATGG No data
1035662096_1035662107 4 Left 1035662096 8:1356008-1356030 CCCTCCCTGCCTTGCATGATCGG No data
Right 1035662107 8:1356035-1356057 ACTGCACTGTCGGTCAGTATGGG No data
1035662096_1035662109 8 Left 1035662096 8:1356008-1356030 CCCTCCCTGCCTTGCATGATCGG No data
Right 1035662109 8:1356039-1356061 CACTGTCGGTCAGTATGGGGCGG No data
1035662096_1035662104 -6 Left 1035662096 8:1356008-1356030 CCCTCCCTGCCTTGCATGATCGG No data
Right 1035662104 8:1356025-1356047 GATCGGGGCCACTGCACTGTCGG No data
1035662096_1035662108 5 Left 1035662096 8:1356008-1356030 CCCTCCCTGCCTTGCATGATCGG No data
Right 1035662108 8:1356036-1356058 CTGCACTGTCGGTCAGTATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035662096 Original CRISPR CCGATCATGCAAGGCAGGGA GGG (reversed) Intergenic
No off target data available for this crispr