ID: 1035663006

View in Genome Browser
Species Human (GRCh38)
Location 8:1361342-1361364
Sequence CTACTTCAGATGCTATTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035663003_1035663006 -10 Left 1035663003 8:1361329-1361351 CCCTCCACAGTCTCTACTTCAGA No data
Right 1035663006 8:1361342-1361364 CTACTTCAGATGCTATTTATAGG No data
1035663001_1035663006 21 Left 1035663001 8:1361298-1361320 CCCAACACACAACTTTAGAGTAG No data
Right 1035663006 8:1361342-1361364 CTACTTCAGATGCTATTTATAGG No data
1035663002_1035663006 20 Left 1035663002 8:1361299-1361321 CCAACACACAACTTTAGAGTAGA No data
Right 1035663006 8:1361342-1361364 CTACTTCAGATGCTATTTATAGG No data
1035663000_1035663006 22 Left 1035663000 8:1361297-1361319 CCCCAACACACAACTTTAGAGTA No data
Right 1035663006 8:1361342-1361364 CTACTTCAGATGCTATTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035663006 Original CRISPR CTACTTCAGATGCTATTTAT AGG Intergenic
No off target data available for this crispr