ID: 1035663421

View in Genome Browser
Species Human (GRCh38)
Location 8:1363803-1363825
Sequence GCTGCGGGTGTGACAGAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035663415_1035663421 5 Left 1035663415 8:1363775-1363797 CCACGGGCGACTGAGCCAGGCCT No data
Right 1035663421 8:1363803-1363825 GCTGCGGGTGTGACAGAGCCCGG No data
1035663419_1035663421 -10 Left 1035663419 8:1363790-1363812 CCAGGCCTCAGAGGCTGCGGGTG No data
Right 1035663421 8:1363803-1363825 GCTGCGGGTGTGACAGAGCCCGG No data
1035663412_1035663421 21 Left 1035663412 8:1363759-1363781 CCTTGCTGTGTGGGAACCACGGG No data
Right 1035663421 8:1363803-1363825 GCTGCGGGTGTGACAGAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035663421 Original CRISPR GCTGCGGGTGTGACAGAGCC CGG Intergenic
No off target data available for this crispr