ID: 1035664209

View in Genome Browser
Species Human (GRCh38)
Location 8:1368833-1368855
Sequence CATCAGGAATAGATGGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 198}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035664209_1035664216 22 Left 1035664209 8:1368833-1368855 CCTGGAACCATCTATTCCTGATG 0: 1
1: 0
2: 1
3: 22
4: 198
Right 1035664216 8:1368878-1368900 TTGACTGCGATGGCTCTAAGTGG 0: 1
1: 0
2: 0
3: 3
4: 48
1035664209_1035664215 12 Left 1035664209 8:1368833-1368855 CCTGGAACCATCTATTCCTGATG 0: 1
1: 0
2: 1
3: 22
4: 198
Right 1035664215 8:1368868-1368890 AAAGGTCAAATTGACTGCGATGG 0: 1
1: 0
2: 0
3: 6
4: 98
1035664209_1035664212 -6 Left 1035664209 8:1368833-1368855 CCTGGAACCATCTATTCCTGATG 0: 1
1: 0
2: 1
3: 22
4: 198
Right 1035664212 8:1368850-1368872 CTGATGCTCTCCCAGCACAAAGG 0: 1
1: 0
2: 2
3: 14
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035664209 Original CRISPR CATCAGGAATAGATGGTTCC AGG (reversed) Intergenic
900081622 1:862791-862813 CATCAGGCATGGCTGGATCCAGG + Intergenic
900269678 1:1780748-1780770 CAGCAGGAACAGAAGGGTCCAGG + Intergenic
901826442 1:11864809-11864831 CATCAGGCATTGCTGGATCCAGG - Intergenic
902089276 1:13890359-13890381 CATAAGGAAAAGATGGTTTTGGG + Intergenic
903332330 1:22602480-22602502 CAACAGGAAAACAGGGTTCCCGG + Exonic
903663092 1:24990639-24990661 CTTCAGGCACAGATGGATCCGGG + Intergenic
904379919 1:30103651-30103673 CTTGAGTGATAGATGGTTCCTGG - Intergenic
904519906 1:31086912-31086934 CATCAGGAATAGACTGTGGCAGG + Intergenic
904658447 1:32067070-32067092 CTTCAGGTATAGTTGGATCCAGG + Intergenic
906501174 1:46342611-46342633 CATGGGGACGAGATGGTTCCTGG - Intronic
906799132 1:48720889-48720911 CTTTAGGAATAGATGGTAACAGG + Intronic
908379610 1:63583831-63583853 CATCAGGAATTTATTGTTTCAGG - Intronic
909197169 1:72642048-72642070 CAGCAGGAATATATTGTTACAGG - Intergenic
910228991 1:84967229-84967251 CTTCAGGAATAGCTGGATCCAGG - Intronic
912221109 1:107676540-107676562 CTTCAGGCAGAGATGGATCCAGG - Intronic
913210294 1:116576603-116576625 CATTAGGAGTAGATGGTGCCCGG - Exonic
919577225 1:199325904-199325926 TTTCAGGAATAGATGCTGCCTGG - Intergenic
919725224 1:200878124-200878146 CCTCAGGATTAGCTTGTTCCAGG + Intergenic
919923246 1:202178571-202178593 AATAAGGACTAGAAGGTTCCTGG - Intergenic
920659269 1:207901571-207901593 TAGCAGGAAGAGATGGCTCCTGG - Intronic
923087909 1:230715133-230715155 GAGCAGGAAGAGATGGTGCCTGG + Intergenic
1063223638 10:3993891-3993913 AATCAGGAATAAAATGTTCCTGG + Intergenic
1063990290 10:11554072-11554094 CATTAGGTAAAGATGGTTGCTGG + Intronic
1064036574 10:11918297-11918319 AATCAGTAATTGATGGTTTCAGG - Intergenic
1074200156 10:111227444-111227466 CTTCAGGCATGGATGGATCCAGG + Intergenic
1075485606 10:122819779-122819801 CATCAGGAATAGCTGGAACCAGG - Intergenic
1076260704 10:129062992-129063014 AAATAGGAATAGATGGTTGCTGG - Intergenic
1080018432 11:27532518-27532540 CAGCAGGAATAGCTGGTGCTTGG - Intergenic
1081275413 11:41142247-41142269 CATTAGGAATAGAAGGGTCATGG + Intronic
1081804512 11:45883119-45883141 CATGGGGAAGAGATGGTTGCAGG + Exonic
1082631345 11:55545715-55545737 GAACAAGAAGAGATGGTTCCTGG + Intergenic
1084404605 11:68963960-68963982 CATGAGGAATACCTGGATCCTGG - Intergenic
1084404635 11:68964125-68964147 CATCAGACATAGCTGGATCCTGG - Intergenic
1084480867 11:69419293-69419315 CAGCAGGAAGAAATGGTGCCAGG + Intergenic
1084494515 11:69496251-69496273 CTTCAGGCATAGCTGGTTCCAGG + Intergenic
1086227041 11:84524604-84524626 CCTCAAGACTAGATGCTTCCAGG + Intronic
1086739992 11:90354699-90354721 CTTCAGGAACAGGTGGATCCTGG + Intergenic
1087575986 11:99990306-99990328 CATCAGGAATAAATTGATCAAGG - Intronic
1088712909 11:112524512-112524534 CACCTGGAAGAGATGGTTCGGGG + Intergenic
1089685807 11:120146082-120146104 CAGCACGAATAGATGGTACAGGG - Intronic
1090408862 11:126493868-126493890 AACCAGGAAAGGATGGTTCCGGG - Intronic
1090462578 11:126905304-126905326 CACCAGGAATACAGGATTCCTGG + Intronic
1093326326 12:17779413-17779435 AATCAGGAATACAAGATTCCTGG + Intergenic
1098154004 12:67578314-67578336 CATCCGGAATAGACATTTCCTGG - Intergenic
1099442412 12:82714577-82714599 GATCAGGAACAGCAGGTTCCAGG - Intronic
1101730459 12:107422813-107422835 TTTCAGGCATAGTTGGTTCCAGG + Intronic
1102175894 12:110874528-110874550 CTTCAGGCATAGCTGGATCCAGG + Intronic
1102542573 12:113633202-113633224 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1103034452 12:117645256-117645278 CATCAGGAATGGCTGGATCCAGG - Intronic
1103979266 12:124726021-124726043 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1104057170 12:125239439-125239461 CGTCAGGAATGGTTGGATCCAGG + Intronic
1104420617 12:128631669-128631691 CTTCAGGCACAGTTGGTTCCAGG + Intronic
1104434515 12:128745178-128745200 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1104513608 12:129403875-129403897 TATCAAGAAGAGCTGGTTCCAGG + Intronic
1104551604 12:129762114-129762136 CATCAGGAACAGATTGATCCAGG - Intronic
1105041233 12:132962957-132962979 CTTCAGGAATAGCTGACTCCAGG - Intergenic
1107581859 13:41798484-41798506 CATCAGCAATAGTAGATTCCAGG - Intronic
1108392145 13:49956830-49956852 GAACATGAAGAGATGGTTCCTGG - Intergenic
1109790662 13:67243004-67243026 CATCAGGAGAAGGTGGTTCAGGG - Intergenic
1112132784 13:96542141-96542163 CATAAGAAAGAGATGGTCCCTGG + Intronic
1112677732 13:101722935-101722957 CATCATGCAAAGATGGTTCTCGG + Exonic
1114614899 14:24063058-24063080 CATGAGGAATGGATGGCTCTGGG + Intronic
1117077595 14:52119774-52119796 CACCTGGAAGAGAGGGTTCCTGG + Intergenic
1117343602 14:54812031-54812053 CATCAGGTACAGCTGGATCCAGG + Intergenic
1120784755 14:88522917-88522939 CATCAGGCAAAGATTTTTCCTGG + Intronic
1121993286 14:98582064-98582086 AATCAGGCAAAGATGGTTCAGGG - Intergenic
1123689440 15:22824447-22824469 CATCAGAGAGAGATGGTGCCAGG - Exonic
1126517847 15:49556076-49556098 AATCAGGATGAAATGGTTCCCGG - Intronic
1128778293 15:70340750-70340772 CCTCAGGAGTAGCTGGATCCAGG + Intergenic
1128995317 15:72290459-72290481 CATCAGGAAAACCTGGGTCCTGG + Intronic
1129152089 15:73695750-73695772 CTTCAGGCATAGCTGGATCCAGG + Intronic
1132531621 16:453372-453394 CATCAGAAATAGATGTGGCCAGG - Intronic
1133338537 16:5022049-5022071 CTTCAGGTATAGCTGGATCCAGG + Intergenic
1133431461 16:5740610-5740632 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1134457908 16:14407964-14407986 CTTCAGGAATGGCTGGATCCAGG - Intergenic
1135048843 16:19176091-19176113 CTTCAGGCATAGCTGGATCCAGG + Intronic
1135061132 16:19272227-19272249 CGTCAGGAATAGCTATTTCCTGG + Intergenic
1135793670 16:25421777-25421799 CATCAGGAATGGTTGGATCCAGG + Intergenic
1135806113 16:25544454-25544476 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1135875623 16:26197383-26197405 CTTCAGGCATAGTTGGATCCAGG - Intergenic
1136041599 16:27583818-27583840 CATCAGGCATGGATGGATCTAGG + Intronic
1139150827 16:64380820-64380842 CATCTGGAATAGCTGTTGCCAGG + Intergenic
1139192279 16:64878839-64878861 CCACAGGAATAGATGGATTCCGG - Intergenic
1140518413 16:75561414-75561436 CTTCTGGAATAGATGGATCTAGG + Intergenic
1140884549 16:79231481-79231503 CACCAAGAATAGAAGATTCCTGG + Intergenic
1142124806 16:88404968-88404990 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1144836731 17:18160348-18160370 CCTCAGGCATAGCTGGATCCAGG + Intronic
1144867521 17:18346277-18346299 GAACATGAAAAGATGGTTCCGGG + Intronic
1147467608 17:40622710-40622732 CATCAGGAAGAGGTGGTTAAAGG + Intergenic
1147930230 17:43975187-43975209 CATTAAGAACAGATGGTTCTGGG - Intronic
1148657051 17:49292957-49292979 GATCAGGAAAAGAATGTTCCAGG + Intronic
1149425867 17:56554191-56554213 CATCAGGAAATGATATTTCCAGG - Intergenic
1149999041 17:61420936-61420958 CTTCAGGCATAGCTGGTTCCAGG + Intergenic
1152062367 17:78087122-78087144 CATCAGGTAGAGAGGGTACCTGG + Intronic
1152656143 17:81519976-81519998 CAGCAGGAAAAGGTGGCTCCAGG + Intronic
1154087183 18:11318828-11318850 CTTCAGGAAGAAATGCTTCCAGG - Intergenic
1155874724 18:31071932-31071954 CATCAGGAATATCTGTTTCTAGG - Intronic
1156007039 18:32454111-32454133 CATTAGGGATGGATGGTTCAGGG + Intronic
1156464071 18:37337481-37337503 CATCAGGAACAGCTGCCTCCTGG - Intronic
1158201245 18:54943606-54943628 CACCAGGGATAAATAGTTCCTGG - Intronic
1158273261 18:55739367-55739389 CATCAGGAATCTTTGATTCCTGG + Intergenic
1159497821 18:69228684-69228706 CTTCAGAAAAAGATGTTTCCAGG - Intergenic
1160678507 19:402964-402986 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1161541773 19:4856152-4856174 CATCAGAAATAGGTGATCCCTGG - Intronic
1161623881 19:5314417-5314439 CTTCAGGCATAGTTGGATCCAGG - Intronic
1163654137 19:18535872-18535894 CTTCAGGCATAGCTGGATCCAGG - Intronic
1164916251 19:32054469-32054491 CTTCAGGTATAGCTGGATCCAGG - Intergenic
1165112173 19:33508866-33508888 CATGAGGCAGGGATGGTTCCAGG - Intronic
1165454871 19:35904516-35904538 CTTCAGGAATGGCTGGATCCAGG + Exonic
1167010714 19:46805600-46805622 CTTCAGGCATAGCTGGCTCCAGG - Intergenic
1167090737 19:47341866-47341888 CTTCAGGCATAGCTGGATCCAGG + Exonic
1167536184 19:50053334-50053356 CTTCAGGAACAGATGGATCCAGG - Intronic
1167536778 19:50058605-50058627 CTTCAGGAACAGATGGATCCAGG - Intergenic
929281059 2:40079261-40079283 CATCTGGAAAAGATAGTTCTGGG + Intergenic
929482631 2:42325056-42325078 CATCAGGAATACAGTTTTCCTGG - Intronic
930014918 2:46963714-46963736 CATCAGGCATAGCTGAATCCGGG + Intronic
930866417 2:56126442-56126464 CTCCAGGAATAGCTGGATCCAGG - Intergenic
931992027 2:67800034-67800056 CTTAAGGCATAGATGGTGCCTGG + Intergenic
933167086 2:79088121-79088143 CATCAGGAATAGCTTATTCCTGG + Intergenic
933767760 2:85721956-85721978 CTTCAGGAATGGATGGCTCTTGG + Intergenic
934985598 2:98882576-98882598 CTTCAGGAATAGCTGGATCCAGG - Intronic
935145748 2:100394158-100394180 AGTCAGGAATAGATGGTGCCAGG + Intronic
936021842 2:109001193-109001215 CCTCAGGAGTGAATGGTTCCTGG - Intergenic
936092090 2:109507994-109508016 CTTCAGGCATAGCTGGGTCCAGG + Intergenic
936616156 2:114049701-114049723 CAACAGGAATAGATGTTCCCAGG + Intergenic
938948737 2:136238154-136238176 CTTCAGGTAAAGATGGATCCAGG + Intergenic
942555177 2:177165415-177165437 CTTTAGGAAAAGATGGCTCCTGG + Intergenic
943146235 2:184049318-184049340 GAACATGAAAAGATGGTTCCTGG - Intergenic
944337283 2:198550600-198550622 AATCTGGAATAGTAGGTTCCAGG + Intronic
944907133 2:204273400-204273422 CTTCAGGCATAGCTGGTTCCAGG + Intergenic
948108063 2:235430899-235430921 CTTCAGGAACAGCTGGATCCAGG - Intergenic
1168960238 20:1864077-1864099 CACCAGGAATTGATGCCTCCTGG - Intergenic
1168983793 20:2030073-2030095 CTTCAGGAACAGGTGGATCCAGG + Intergenic
1170456777 20:16541105-16541127 CAGCAGGAAGACATGGTTTCGGG - Intronic
1172043876 20:32065444-32065466 CCTCAGGCATAGCTGGATCCAGG + Intronic
1172692867 20:36802702-36802724 CTTCAGGTATAGCTGGATCCAGG - Intronic
1172825406 20:37778939-37778961 CATCAGTAATTGACAGTTCCAGG - Intronic
1173942320 20:46921779-46921801 CTTCAGGAACAGCTGGATCCAGG - Intronic
1174067836 20:47878545-47878567 CAACAGGAATAGAAGGTATCCGG - Intergenic
1174085219 20:48003199-48003221 CTTCAGGCATGGATGGATCCAGG + Intergenic
1174301174 20:49583659-49583681 CATCAGGGGTAGAGGGTTCAGGG + Intergenic
1174427179 20:50440005-50440027 CTTCAGGAATGGCTGGATCCAGG - Intergenic
1174518219 20:51109606-51109628 CTTCAGGCATGGATGGATCCAGG - Intergenic
1174539405 20:51277177-51277199 CTTCAGGAATGGCTGATTCCAGG - Intergenic
1175228460 20:57459163-57459185 CTTCAGGCACAGATGGATCCAGG + Intergenic
1175489373 20:59369081-59369103 CATCTTGAATACATTGTTCCTGG + Intergenic
1176364057 21:6021898-6021920 CATGTAGAAGAGATGGTTCCAGG + Intergenic
1177711959 21:24788301-24788323 CATCAGGAAGACATGGTTAATGG - Intergenic
1177797705 21:25795980-25796002 CATCCGGTAAAGATGGCTCCTGG + Intergenic
1179759461 21:43516647-43516669 CATGTAGAAGAGATGGTTCCAGG - Intergenic
1181733782 22:24866532-24866554 CTTCAGGCATGGATGGATCCAGG + Intronic
1182323993 22:29497804-29497826 CTTCAGGAATGGCTGGATCCAGG + Intergenic
1183232934 22:36594088-36594110 CTTCAGGCACAGATGGATCCAGG + Intronic
1183322390 22:37172989-37173011 CAGAAGGAAGGGATGGTTCCTGG - Intronic
1185238102 22:49726216-49726238 CTTCAGGAATGGCTGGATCCAGG + Intergenic
949539668 3:5022255-5022277 CTTCAGGCATAGCTGTTTCCAGG - Intergenic
949583122 3:5410977-5410999 CTTCAGGAATAGCTGGGTCCAGG - Intergenic
950190970 3:10975894-10975916 CATCAGGCATGGCTGGATCCAGG + Intergenic
953261118 3:41339820-41339842 CAACAGTAATAGATGGGTCTTGG - Intronic
955352003 3:58200494-58200516 CTTCAGGCATAGCTGGATCCAGG - Intronic
955511484 3:59685327-59685349 CTTCAGGCACAGATGGATCCAGG + Intergenic
956361778 3:68455761-68455783 CAGCAGGAATTTATTGTTCCAGG + Intronic
956380954 3:68663916-68663938 CTTCAGGAATAGCTGAATCCAGG - Intergenic
956577243 3:70765537-70765559 CAACAGTATTAGATGTTTCCTGG + Intergenic
956722885 3:72133818-72133840 CTTCAGGTATAGCTGGATCCAGG + Intergenic
956779777 3:72594788-72594810 CATCAGGCATTGCTGGATCCAGG + Intergenic
957964230 3:87301966-87301988 TATCTGAAATAGATGGTTCATGG + Intergenic
960425541 3:117502500-117502522 CATTAGCAATAGATATTTCCTGG - Intergenic
962835839 3:139187715-139187737 CTTCATGAATGGATGGATCCAGG + Intronic
965614392 3:170578147-170578169 CACCAGAAATAGATGGATGCTGG - Intronic
965616318 3:170596384-170596406 CTTCAGGCATAGCTGGGTCCAGG + Intronic
971052142 4:22873437-22873459 CTGCTGGAAGAGATGGTTCCAGG - Intergenic
977407419 4:96617636-96617658 CATCAGGAATATCTGGGTCAAGG - Intergenic
978105364 4:104895679-104895701 GAACAGGAAGAGATGGTGCCAGG - Intergenic
982137686 4:152287592-152287614 CATCAGGCATGGCTGGATCCAGG - Intergenic
982842142 4:160202912-160202934 TATAAGGAATAGATTGTTCCTGG + Intergenic
986685489 5:10272383-10272405 GAACAGGAAGAGATGGCTCCAGG - Intergenic
988105967 5:26748359-26748381 CCTAGGGGATAGATGGTTCCAGG + Intergenic
988285840 5:29214711-29214733 CATCAGGCATCCATGCTTCCTGG + Intergenic
992154692 5:73943502-73943524 CATCAGGACTACATAATTCCTGG + Intergenic
992363277 5:76064597-76064619 AATCAGGAAGAGATGGTTCCTGG + Intergenic
995947964 5:117672790-117672812 CCTCAGGAATTGATGGTACTAGG + Intergenic
997295204 5:132764577-132764599 CCACAGGAAAAGATAGTTCCTGG - Intronic
999154253 5:149447013-149447035 CTTCAGGCATGGCTGGTTCCAGG + Intergenic
999685351 5:154097810-154097832 CATCAGGGAAAGAAGGTTGCTGG + Intronic
999860036 5:155634843-155634865 AAACAGAATTAGATGGTTCCAGG + Intergenic
1001146625 5:169190374-169190396 CTTCAGGAACAGCTGGATCCAGG - Intronic
1001198762 5:169697186-169697208 CTTCAGGCATAGCTGGATCCAGG + Intronic
1001441186 5:171744238-171744260 CTTCAGGAACTGATGGATCCAGG + Intergenic
1002129688 5:177072849-177072871 CTTCAGGCATAGCTGGATCCAGG - Intronic
1004880634 6:20003904-20003926 CAGCAGTAACAGATGGTTCTCGG - Intergenic
1009212063 6:60873943-60873965 CAGCAGTAGTAGATGTTTCCTGG - Intergenic
1010964768 6:82192444-82192466 CATTAGAAATAGATGATTTCTGG + Intronic
1011925483 6:92638983-92639005 CATCTGGAAGAGATGGTTTGAGG + Intergenic
1018262463 6:161984211-161984233 CATCAGGCATAGCTGGATCCAGG - Intronic
1019516497 7:1442504-1442526 CATCAGGCACAGCTGGATCCAGG + Intronic
1021805235 7:24348837-24348859 GATCAAGAATAGGTGGTTTCTGG - Intergenic
1022139244 7:27478367-27478389 CATGAGTAAGACATGGTTCCAGG + Intergenic
1026098836 7:67368308-67368330 CATGAGGAATAAATGTTTCTTGG + Intergenic
1031714040 7:125085044-125085066 GAACAGGAAGAGATGGTGCCTGG - Intergenic
1032521150 7:132546245-132546267 ATGCAGGAATAGATGCTTCCAGG + Intronic
1034219574 7:149433312-149433334 CATCAGGCATGGCTGGATCCAGG - Intronic
1035523646 8:294759-294781 CATCAGGCATGGCTGGATCCAGG - Intergenic
1035664209 8:1368833-1368855 CATCAGGAATAGATGGTTCCAGG - Intergenic
1036494577 8:9258646-9258668 ACTCAGGAATTGATGGTTCCAGG + Intergenic
1042218578 8:66451442-66451464 CAGCAGGAATATCTTGTTCCAGG + Intronic
1043375433 8:79644244-79644266 CATCAGGAACAGCTGGATCCAGG + Intronic
1043767430 8:84154321-84154343 GAACAGGAAGAGATGGTTTCTGG - Intergenic
1046564508 8:115882134-115882156 CATCAGGAATAGTTAGTGCTTGG + Intergenic
1047429847 8:124781639-124781661 CAGCAGGAAGAGGTGGTTCTAGG - Intergenic
1047462040 8:125075643-125075665 CATTAGGAAGTGGTGGTTCCTGG - Intronic
1048605758 8:135967150-135967172 CAGAAAGAATAGATGGTACCTGG - Intergenic
1050078513 9:1890196-1890218 CATCAGAAATAGATTGTTTTGGG - Intergenic
1055649175 9:78390292-78390314 CATCAGGTATAGCTGGATCCAGG - Intergenic
1055921805 9:81468622-81468644 CATCAGGAATATGTGATTGCAGG + Intergenic
1057429203 9:94979026-94979048 CATCAGGCATGGCTGCTTCCTGG - Intronic
1189222743 X:39386235-39386257 CATCAGGAATAGCTGGGCCCAGG - Intergenic
1189543655 X:42019332-42019354 CACAAGGAATAGATGTTTCTGGG - Intergenic
1190004645 X:46723707-46723729 CATAAGGAATCCATGCTTCCTGG + Intronic
1190048059 X:47128461-47128483 GATCAGTAATAGATGGTTAGTGG - Intergenic
1196189841 X:112782775-112782797 CATTTGGAACAGATGGTTTCTGG + Intronic
1199206765 X:145158406-145158428 CACCAGGATTATATGGTGCCAGG + Intergenic