ID: 1035664848

View in Genome Browser
Species Human (GRCh38)
Location 8:1373328-1373350
Sequence CCTTCCGGAGGCGCCGCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035664841_1035664848 3 Left 1035664841 8:1373302-1373324 CCGCGGGCGGCAGCTGACGGGCG No data
Right 1035664848 8:1373328-1373350 CCTTCCGGAGGCGCCGCGCCTGG No data
1035664832_1035664848 27 Left 1035664832 8:1373278-1373300 CCCGGAGGGTGTCGGGAGCAGGG No data
Right 1035664848 8:1373328-1373350 CCTTCCGGAGGCGCCGCGCCTGG No data
1035664834_1035664848 26 Left 1035664834 8:1373279-1373301 CCGGAGGGTGTCGGGAGCAGGGG No data
Right 1035664848 8:1373328-1373350 CCTTCCGGAGGCGCCGCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035664848 Original CRISPR CCTTCCGGAGGCGCCGCGCC TGG Intergenic