ID: 1035669786

View in Genome Browser
Species Human (GRCh38)
Location 8:1408501-1408523
Sequence CTCTGGGCCTTGGATGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035669778_1035669786 0 Left 1035669778 8:1408478-1408500 CCATGGCCCTGCAGAGGGACCTT No data
Right 1035669786 8:1408501-1408523 CTCTGGGCCTTGGATGATGAGGG No data
1035669772_1035669786 10 Left 1035669772 8:1408468-1408490 CCTGAAGCCCCCATGGCCCTGCA No data
Right 1035669786 8:1408501-1408523 CTCTGGGCCTTGGATGATGAGGG No data
1035669776_1035669786 2 Left 1035669776 8:1408476-1408498 CCCCATGGCCCTGCAGAGGGACC No data
Right 1035669786 8:1408501-1408523 CTCTGGGCCTTGGATGATGAGGG No data
1035669781_1035669786 -7 Left 1035669781 8:1408485-1408507 CCTGCAGAGGGACCTTCTCTGGG No data
Right 1035669786 8:1408501-1408523 CTCTGGGCCTTGGATGATGAGGG No data
1035669777_1035669786 1 Left 1035669777 8:1408477-1408499 CCCATGGCCCTGCAGAGGGACCT No data
Right 1035669786 8:1408501-1408523 CTCTGGGCCTTGGATGATGAGGG No data
1035669775_1035669786 3 Left 1035669775 8:1408475-1408497 CCCCCATGGCCCTGCAGAGGGAC No data
Right 1035669786 8:1408501-1408523 CTCTGGGCCTTGGATGATGAGGG No data
1035669779_1035669786 -6 Left 1035669779 8:1408484-1408506 CCCTGCAGAGGGACCTTCTCTGG No data
Right 1035669786 8:1408501-1408523 CTCTGGGCCTTGGATGATGAGGG No data
1035669770_1035669786 21 Left 1035669770 8:1408457-1408479 CCGTGTCAAGTCCTGAAGCCCCC No data
Right 1035669786 8:1408501-1408523 CTCTGGGCCTTGGATGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035669786 Original CRISPR CTCTGGGCCTTGGATGATGA GGG Intergenic
No off target data available for this crispr