ID: 1035671950

View in Genome Browser
Species Human (GRCh38)
Location 8:1424869-1424891
Sequence CTGGGGAGGGAGAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035671937_1035671950 25 Left 1035671937 8:1424821-1424843 CCTGGAGGAGTTGGATACACAGA No data
Right 1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035671950 Original CRISPR CTGGGGAGGGAGAATGAGGA GGG Intergenic
No off target data available for this crispr