ID: 1035672097

View in Genome Browser
Species Human (GRCh38)
Location 8:1425946-1425968
Sequence GCTTATGGAAACCAGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035672092_1035672097 -6 Left 1035672092 8:1425929-1425951 CCAGGACCTGATGTAGGGCTTAT No data
Right 1035672097 8:1425946-1425968 GCTTATGGAAACCAGGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035672097 Original CRISPR GCTTATGGAAACCAGGTGGC TGG Intergenic