ID: 1035672596

View in Genome Browser
Species Human (GRCh38)
Location 8:1431788-1431810
Sequence GACACTGATGCGTGCATGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035672595_1035672596 15 Left 1035672595 8:1431750-1431772 CCTTTTCTTTAGTTTGGTGTTTT No data
Right 1035672596 8:1431788-1431810 GACACTGATGCGTGCATGACAGG No data
1035672594_1035672596 19 Left 1035672594 8:1431746-1431768 CCTTCCTTTTCTTTAGTTTGGTG No data
Right 1035672596 8:1431788-1431810 GACACTGATGCGTGCATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035672596 Original CRISPR GACACTGATGCGTGCATGAC AGG Intergenic
No off target data available for this crispr