ID: 1035672955

View in Genome Browser
Species Human (GRCh38)
Location 8:1434093-1434115
Sequence GCTGCTTTGCAGGTGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035672947_1035672955 18 Left 1035672947 8:1434052-1434074 CCCAGAAATGGCGCTGAATGAGG No data
Right 1035672955 8:1434093-1434115 GCTGCTTTGCAGGTGGAGCATGG No data
1035672949_1035672955 17 Left 1035672949 8:1434053-1434075 CCAGAAATGGCGCTGAATGAGGC No data
Right 1035672955 8:1434093-1434115 GCTGCTTTGCAGGTGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035672955 Original CRISPR GCTGCTTTGCAGGTGGAGCA TGG Intergenic
No off target data available for this crispr