ID: 1035673656

View in Genome Browser
Species Human (GRCh38)
Location 8:1439373-1439395
Sequence CAGGGTACACGGCAGGACCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035673656_1035673667 20 Left 1035673656 8:1439373-1439395 CCACGGTCCTGCCGTGTACCCTG No data
Right 1035673667 8:1439416-1439438 TGTCCTCTCTAGTTCCTCACGGG No data
1035673656_1035673666 19 Left 1035673656 8:1439373-1439395 CCACGGTCCTGCCGTGTACCCTG No data
Right 1035673666 8:1439415-1439437 GTGTCCTCTCTAGTTCCTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035673656 Original CRISPR CAGGGTACACGGCAGGACCG TGG (reversed) Intergenic
No off target data available for this crispr