ID: 1035674083

View in Genome Browser
Species Human (GRCh38)
Location 8:1442552-1442574
Sequence GATCCGGGCGTAGACCCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035674072_1035674083 16 Left 1035674072 8:1442513-1442535 CCCGCCAGGCTGCTGTGGGTTCA No data
Right 1035674083 8:1442552-1442574 GATCCGGGCGTAGACCCGCCAGG No data
1035674069_1035674083 27 Left 1035674069 8:1442502-1442524 CCGGGCATAGACCCGCCAGGCTG No data
Right 1035674083 8:1442552-1442574 GATCCGGGCGTAGACCCGCCAGG No data
1035674074_1035674083 12 Left 1035674074 8:1442517-1442539 CCAGGCTGCTGTGGGTTCAGCCA No data
Right 1035674083 8:1442552-1442574 GATCCGGGCGTAGACCCGCCAGG No data
1035674081_1035674083 -8 Left 1035674081 8:1442537-1442559 CCACTGGGGGAGACGGATCCGGG No data
Right 1035674083 8:1442552-1442574 GATCCGGGCGTAGACCCGCCAGG No data
1035674073_1035674083 15 Left 1035674073 8:1442514-1442536 CCGCCAGGCTGCTGTGGGTTCAG No data
Right 1035674083 8:1442552-1442574 GATCCGGGCGTAGACCCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035674083 Original CRISPR GATCCGGGCGTAGACCCGCC AGG Intergenic
No off target data available for this crispr