ID: 1035674211

View in Genome Browser
Species Human (GRCh38)
Location 8:1443469-1443491
Sequence CTCTTGCAGGAGAAGACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035674211_1035674218 -10 Left 1035674211 8:1443469-1443491 CCCTCAGTCTTCTCCTGCAAGAG No data
Right 1035674218 8:1443482-1443504 CCTGCAAGAGAGGGGTGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035674211 Original CRISPR CTCTTGCAGGAGAAGACTGA GGG (reversed) Intergenic
No off target data available for this crispr