ID: 1035674218

View in Genome Browser
Species Human (GRCh38)
Location 8:1443482-1443504
Sequence CCTGCAAGAGAGGGGTGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035674210_1035674218 28 Left 1035674210 8:1443431-1443453 CCAGTTTCACTTAATGCTTCATG No data
Right 1035674218 8:1443482-1443504 CCTGCAAGAGAGGGGTGGCGTGG No data
1035674211_1035674218 -10 Left 1035674211 8:1443469-1443491 CCCTCAGTCTTCTCCTGCAAGAG No data
Right 1035674218 8:1443482-1443504 CCTGCAAGAGAGGGGTGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035674218 Original CRISPR CCTGCAAGAGAGGGGTGGCG TGG Intergenic
No off target data available for this crispr