ID: 1035675581

View in Genome Browser
Species Human (GRCh38)
Location 8:1453268-1453290
Sequence GGGGAGAAGCAGGAGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035675575_1035675581 -3 Left 1035675575 8:1453248-1453270 CCGTGCTGGCCGGTCAGGCTGGG No data
Right 1035675581 8:1453268-1453290 GGGGAGAAGCAGGAGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035675581 Original CRISPR GGGGAGAAGCAGGAGGAGCC TGG Intergenic
No off target data available for this crispr