ID: 1035677745

View in Genome Browser
Species Human (GRCh38)
Location 8:1467245-1467267
Sequence GGGGCTGGGGGGAGGGACCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035677745_1035677758 14 Left 1035677745 8:1467245-1467267 CCACGGTCCCTCCCCCCAGCCCC No data
Right 1035677758 8:1467282-1467304 TCCACATCCAGCCCTCCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035677745 Original CRISPR GGGGCTGGGGGGAGGGACCG TGG (reversed) Intergenic
No off target data available for this crispr