ID: 1035681959

View in Genome Browser
Species Human (GRCh38)
Location 8:1494850-1494872
Sequence GAGATCTAACTCTTCTGTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035681956_1035681959 3 Left 1035681956 8:1494824-1494846 CCACGGGGTTGAGGCTCAGCTTC No data
Right 1035681959 8:1494850-1494872 GAGATCTAACTCTTCTGTGGCGG No data
1035681955_1035681959 7 Left 1035681955 8:1494820-1494842 CCAGCCACGGGGTTGAGGCTCAG No data
Right 1035681959 8:1494850-1494872 GAGATCTAACTCTTCTGTGGCGG No data
1035681950_1035681959 26 Left 1035681950 8:1494801-1494823 CCACAGAGCACACAGAGCTCCAG No data
Right 1035681959 8:1494850-1494872 GAGATCTAACTCTTCTGTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035681959 Original CRISPR GAGATCTAACTCTTCTGTGG CGG Intergenic
No off target data available for this crispr